Novel cAMP Regulatory Elements in the Promoter Region of Bovine P-450(11β) Gene11

Publisher Website
Google Scholar
Abstract
In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11β) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11β-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at −306 bp to −284 bp and Ad4 (CCAAGGTC) is located at −331 bp to −324 bp in the promoter region of the P-450(11β) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11β) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11β) gene, and named them Ad5 and Ad6. However, these two sequences do not seem to contribute to the cAMP induction of the gene.