Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Open Access
Publisher Website
Google Scholar
Abstract
Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non‐transcribed spacers of r‐chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I‐DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3′ end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence‐specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8‐fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6‐kb fragment investigated; the sequence specific cleavage is increased 2‐ to 3‐fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(‐10) M.