Two Drosophila melanogaster tRNAGlygenes are contained in a direct duplication at chromosomal locus 56F
- 1 January 1980
- journal article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 8 (21) , 4899-4910
- https://doi.org/10.1093/nar/8.21.4899
Abstract
One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.Keywords
This publication has 29 references indexed in Scilit:
- Detection of specific sequences among DNA fragments separated by gel electrophoresisPublished by Elsevier ,2006
- Analysis of a drosophila tRNA gene clusterCell, 1980
- Nucleotide sequence of genes coding for tRNAPhe and tRNATyr from a repeating unit of X. laevis DNACell, 1980
- Transcription of a cloned bombyx mori trna2Ala gene: Nucleotide sequence of the tRNA precursor and its processing in vitroCell, 1979
- Splicing of yeast tRNA precursors: structure of the reaction intermediatesCell, 1979
- Genes coding for valine transfer ribonucleic acid-3b in Drosophila melanogasterJournal of Molecular Biology, 1979
- Sequence arrangement of tRNA genes on a fragment of drosophila melanogaster DNA cloned in E. coliCell, 1977
- Screening λgt Recombinant Clones by Hybridization to Single Plaques in SituScience, 1977
- Base sequence complexity of the stable RNA species of Drosophila melanogasterBiochemistry, 1976
- The 5 s RNA genes of Drosophila melanogasterJournal of Molecular Biology, 1970