The nucleotide sequence of chloroplast 4.5 S rRNA from Mnium rugicum (Bryophyta) : mosses also possess this type of RNA
- 15 October 1984
- journal article
- Published by Wiley in FEBS Letters
- Vol. 176 (1) , 105-109
- https://doi.org/10.1016/0014-5793(84)80921-7
Abstract
The complete nucleotide sequence of chloroplast 4.5 S rRNA from the moss Mnium rugicum was determined to be OHUAAGGUGACGGCAAGACUAGCCGUUUAUCAUCACGAUAGGUGCCAAGUGGAAGUGCAGUAAUGUAUGCAGCUGAGGCAUCCUAACAGACCGAGAGAUUUAAACOH. The sequence differs from that of a fern Dryopteris acuminata and of angiosperms 4.5 S rRNA by 8 and 9–14%, respectively. The strong conservation of 4.5 S rRNA in the course of evolution ensures its use for reconstruction of the phylogenetic relations between the higher taxa of plants.Keywords
This publication has 20 references indexed in Scilit:
- Molecular cloning and characterization of the chloroplast ribosomal RNA genes from Spirodela oligorhizaCurrent Genetics, 1983
- The Complete Nucleotide Sequence of a 23‐S rRNA Gene from Tobacco ChloroplastsEuropean Journal of Biochemistry, 1982
- Molecular cloning of the genes for ribosomal DNAs from broad bean chloroplast DNA.The Japanese Journal of Genetics, 1982
- The origin of plant chloroplast 4.5 S ribosomal RNAFEBS Letters, 1981
- Nucleotide sequences of the 4.5 S and 5 S ribosomal RNA genes from tobacco chloroplastsMolecular Genetics and Genomics, 1980
- Cloning and characterization of 4.5S and 5S RNA genes in tobacco chloroplastsGene, 1980
- Characterization of the cloned ribosomal DNA of tobacco chloroplastsMolecular Genetics and Genomics, 1980
- The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplastsNucleic Acids Research, 1980
- Isolation of Euglena gracilis chloroplast 5S ribosomal RNA and mapping the 5S rRNA gene on chloroplast DNABiochemistry, 1979
- Anatomy of the chloroplast ribosomal DNA of chlamydomonas reinhardiiCell, 1978