The nucleotide sequence of 5S rRNA from Mycoplasma capricolum
- 24 October 1981
- journal article
- research article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 9 (20) , 5407-5410
- https://doi.org/10.1093/nar/9.20.5407
Abstract
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACUGAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.Keywords
This publication has 18 references indexed in Scilit:
- Studies on the Sequence of the 3′‐Terminal Region of Turnip‐Yellow‐Mosaic‐Virus RNAEuropean Journal of Biochemistry, 1977
- The first nucleotide sequence of an organelle transfer RNA: Chloroplastic tRNAPheCell, 1976
- The primary structure of Bacillus subtilis and Bacillus stearothermophilus 5 S ribonucleic acids.Journal of Biological Chemistry, 1976
- A fragment of 23S RNA containing a nucleotide sequence complementary to a region of 5S RNAFEBS Letters, 1975
- Characterization of Some Caprine Mycoplasmas, with Proposals for New Species, Mycoplasma capricolum and Mycoplasma putrefaciensJournal of General Microbiology, 1974
- Physiology of MycoplasmasPublished by Elsevier ,1973
- Cell biology of the mycoplasmas.1972
- Genome size and evolutionChromosoma, 1972
- Nucleotide Sequence of 5S-ribosomal RNA from Escherichia coliNature, 1967
- Isolation and Analysis of the Deoxyribonucleic Acid of Mycoplasma mycoides var. capriNature, 1963