Affinity modification of human immunodeficiency virus reverse transcriptase and DNA template by photoreactive dCTP analogs

Publisher Website
Google Scholar
Abstract
New base‐substituted analogs of dCTP containing an azido group have been synthesized and applied to a selective photoaffinity modification of HIV‐RT (p66/p51 heterodimer). The labeling of only the 66 kDa subunit of HIV‐RT was detected when the enzyme was first irradiated with the analogs and then template (5′‐(d)GGTTAAATAAAATAGTAAGAATGTATAGCCCCTACCA‐3′) and 5′ 32P end‐labeled 3′‐(d)TTACATATCGGGGATGGT‐5′primer were added. The 5′ 32P end‐labeled primer elongated by dCTP analogs in the presence of both HIV‐RT and DNA template is able to modify both subunits of HIV‐RT and DNA template. This way of specific cross‐linking to both DNA (RNA) template and HIV‐RT opens up new possibilities to study the HIV‐RT active site.