The nucleotide sequence of 5S ribosomal RNA from Micrococcus Iysodeikticus
Open Access
- 1 January 1980
- journal article
- research article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 8 (22) , 5423-5426
- https://doi.org/10.1093/nar/8.22.5423
Abstract
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGA0H. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.Keywords
This publication has 9 references indexed in Scilit:
- Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.Proceedings of the National Academy of Sciences, 1979
- Nucleotide sequence of Halobacterium cutirubrum ribosomal 5 S ribonucleic acid. An altered secondary structure in halophilic organismsJournal of Biological Chemistry, 1978
- Studies on the Sequence of the 3′‐Terminal Region of Turnip‐Yellow‐Mosaic‐Virus RNAEuropean Journal of Biochemistry, 1977
- The primary structure of Bacillus subtilis and Bacillus stearothermophilus 5 S ribonucleic acids.Journal of Biological Chemistry, 1976
- Molecular evolution of 5S RNAMolecular Genetics and Genomics, 1976
- 5S RNA secondary structureNature, 1975
- Chapter 4 Preparation of RNA and Ribosomes from YeastPublished by Elsevier ,1975
- Minor components in transfer RNA: their characterization, location, and function.1972
- Nucleotide Sequence of 5S-ribosomal RNA from Escherichia coliNature, 1967