The nucleotide sequence of 5.8S rRNA from the posterior silk gland of the silkwormPhilosamia cynthia ricini

Open Access
Publisher Website
Google Scholar
Abstract
The nucleotide sequence of 5.8S rRNA from the Chinese silkworm, Philosamia cynthia ricini has been determined by gel sequencing and mobility shift methods. The complete primary structure is pAAACCAUUACCCUGGACGGUGGAUCACUUG GCUCGCGGGUCGAUGAAGAACGCAGUUAACUGCGCGUCAUAGUGUGAACUGmCAGGACACAUUUGAACAUCGAC AUUUCGAACGCACAUUGCGGUCCGUGGAGACACAUCCAGGACCACUCCUGUCUGAGGGCCGAUUAAOH. This is one of the largest known 5.8S rRNAs. As compared to Bombyx 5.8S rRNA, it is two nucleotides longer; two nucleotides near the 5′end and two nucleotides near the 3′end are different, and Ψ61 of the Bombyx RNA sequence is an unmodified U in Philosamia RNA. The secondary structure of Philosamia 5.8S rRNA may differ from the Bombyx RNA structure by three additional base pairs at the 5′/3′ ends.