The clinical utility of the prostate specific membrane antigen reverse‐transcription/polymerase chain reaction to detect circulating prostate cells: an analysis in healthy men and women

Open Access
Publisher Website
Google Scholar
Abstract
Objective To evaluate the overall specificity of nested reverse transcriptase‐polymerase chain reaction (RT‐PCR) to detect prostate‐specific membrane antigen (PSM) mRNA in peripheral blood samples of healthy donors. Subjects and methods Peripheral blood samples were taken from 60 healthy blood‐donors (30 men and 30 women aged < 50 years) and analysed for PSM‐mRNA using nested RT‐PCR (in ‘hot‐start’ conditions and confirmed using nested EcoRI restriction enzyme). Intron‐spanning primer pairs specific for human PSM were deduced from the GenBank sequence (M99487) using gene software. The outer primer pair for PSM was: fwd: 1368 5′‐TCACCGGGACTCATGGGTGT‐3′; reverse: 1860 5′‐GCCTGAAGCAATTCCAAGTCGG‐3′. Inner primer pair for PSM was: fwd: 1480 5′‐AAGGAAGGGTGGAGACCTAG‐3′; reverse: 5‐ACTGAACTCTGGGGAAGGAC‐3′. The integrity of cDNAs was checked using primer pairs specific for the housekeeping gene β‐actin. The specificity and false‐positive rate were calculated assuming that the underlying prostate cancer incidence was nil. Results The first PCR was negative for all samples (100% specificity; 0% false‐positive rate). The nested PCR detected 23 positive samples (23/60, 38%) with an overall specificity of 62% (false positive rate, 38%). Conclusion Nested RT‐PCR of PSM‐mRNA in peripheral blood is highly unspecific. Its clinical utility in the management of prostate cancer must be low. Further development is needed of quantitative RT‐PCR, primers that identify prostatic PSM or another prostate‐specific marker gene to differentiate PSM mRNA from circulating prostate cells and from non‐prostatic tissues.

This publication has 12 references indexed in Scilit: