Sequence of a RNA templated by the 3'-OH RNA terminus of defective interfering particles of vesicular stomatitis virus.
- 1 October 1978
- journal article
- research article
- Published by Proceedings of the National Academy of Sciences in Proceedings of the National Academy of Sciences
- Vol. 75 (10) , 4704-4708
- https://doi.org/10.1073/pnas.75.10.4704
Abstract
The endogenous RNA polymerase product produced by disrupted purified virions of vesicular stomatitis virus defective interfering particles was sequenced by using the newer 1-dimensional rapid gel sequencing techniques and confirming this with a modified 2-dimensional gel vectoring technique. The sequence of this 46-nucleotide RNA is: 5''(pp)pACGAAGACCACAAAACCAGAUAAAAAAUAAAAACCACAAGAGGG(U)COH3''. This sequence is identical to the sequence at the 5'' end of infectious vesicular stomatitis virus RNA and is complementary to the sequence of the 3''-OH terminus of this defective interfering particle genome RNA.This publication has 36 references indexed in Scilit:
- Inverted Complementary Terminal Sequences in Single-Stranded RNAs and Snap-Back RNAs from Vesicular Stomatitis Defective Interfering ParticlesJournal of General Virology, 1978
- Characterization of Snap-back RNAs in Vesicular Stomatitis Defective Interfering Virus ParticlesJournal of General Virology, 1978
- New rapid gel sequencing method for RNANature, 1977
- Further characterization of sendai virus DI-RNAs: A model for their generationCell, 1977
- Vesicular Stomatitis Virus: Mode of TranscriptionJournal of General Virology, 1977
- Sequence relationships between the genome and the intracellular RNA species of standard and defective-interfering semliki forest virusJournal of Molecular Biology, 1976
- Long-Term Persistent Vesicular Stomatitis Virus and Rabies Virus Infection of Cells In VitroJournal of General Virology, 1976
- A unique RNA species involved in initiation of vesicular stomatitis virus RNA transcription in vitroCell, 1976
- The size and the cistronic origin of defective vesicular stomatitis virus particle RNAs in relation to homotypic and heterotypic interferenceJournal of Molecular Biology, 1976
- A two-dimensional fractionation procedure for radioactive nucleotidesJournal of Molecular Biology, 1965