Sequence of a RNA templated by the 3'-OH RNA terminus of defective interfering particles of vesicular stomatitis virus.

Abstract
The endogenous RNA polymerase product produced by disrupted purified virions of vesicular stomatitis virus defective interfering particles was sequenced by using the newer 1-dimensional rapid gel sequencing techniques and confirming this with a modified 2-dimensional gel vectoring technique. The sequence of this 46-nucleotide RNA is: 5''(pp)pACGAAGACCACAAAACCAGAUAAAAAAUAAAAACCACAAGAGGG(U)COH3''. This sequence is identical to the sequence at the 5'' end of infectious vesicular stomatitis virus RNA and is complementary to the sequence of the 3''-OH terminus of this defective interfering particle genome RNA.