α-DNA VII. Solid phase synthesis of α-anomeric oligodeoxyribonucleotides
- 11 February 1988
- journal article
- research article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 16 (3) , 833-847
- https://doi.org/10.1093/nar/16.3.833
Abstract
An efficient procedure for the synthesis of unnatural α-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of α-nucleoside phosphoramidites and α-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 α-deoxynucleotide units in length. After HPLC purification, a 15-mer: α-d(CCTCTCGTTCTTTAC) and a 20-mer α-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.Keywords
This publication has 15 references indexed in Scilit:
- Redefining interferon: the interferon-like antiviral effects of certain cytokines (interleukin-1, interferon-β2, interferon-γ) may be indirect or side effectsAntiviral Research, 1987
- Specific antiviral activity of a poly(L-lysine)-conjugated oligodeoxyribonucleotide sequence complementary to vesicular stomatitis virus N protein mRNA initiation site.Proceedings of the National Academy of Sciences, 1987
- Targeted cleavage of polynucleotides by complementary oligonucleotides covalently linked to iron-porphyrinsBiochemistry, 1986
- Inhibition of vesicular stomatitis virus protein synthesis and infection by sequence-specific oligodeoxyribonucleoside methylphosphonatesBiochemistry, 1986
- Inhibition of replication and expression of human T-cell lymphotropic virus type III in cultured cells by exogenous synthetic oligonucleotides complementary to viral RNA.Proceedings of the National Academy of Sciences, 1986
- Antiviral effect of an oligo(nucleoside methylphosphonate) complementary to the splice junction of herpes simplex virus type 1 immediate early pre-mRNAs 4 and 5.Proceedings of the National Academy of Sciences, 1986
- Specific inhibition of mRNA translation by complementary oligonucleotides covalently linked to intercalating agents.Proceedings of the National Academy of Sciences, 1986
- α-DNA I. Synthesis, characterization by high field1H-NMR, and base-pairing properties of the unnatural hexadeoxyribonudeotide α-[d(CpCpTpTpCpC)] with its complement β-[d(GpGpApApGpG)]Nucleic Acids Research, 1986
- Solid-phase methods for sequencing of nucleic acids I. Simultaneous sequencing of different oligodeoxyribonucleotides using a new, mechanically stable anion-exchange paperNucleic Acids Research, 1985
- Solid-phase synthesis of polynucleotides. II. Synthesis of polythymidylic acids by the block coupling phosphotriester methodNucleic Acids Research, 1980