NASBA Technology: Isothermal RNA Amplification in Qualitative and Quantitative Diagnostics
- 19 March 1997
- book chapter
- Published by Taylor & Francis
Abstract
TATAG~GAGGCCCGGCATGTGGTGCATAA3 1 ; P2= 5 1 CAGTATGCCAAGACCGACTCAGA3' (T. Kievits, personal communication) Italicized sequences are the T7 RNA polymerase promoter region. The primers for the HIV-1 Quantitative Assay have been previously described (14).Keywords
This publication has 1 reference indexed in Scilit:
- A one-tube quantitative HIV-1 RNA NASBA nucleic acid amplification assay using electrochemiluminescent (ECL) labelled probesJournal of Virological Methods, 1994