The nucteotide sequence of the cytoplasmtc 5S rRNA from the horsetail,Equisetum arvense

Abstract
Using 3′- and 5′-end labelling sequencing techniques, the following Sesequence for the cytoplasmic 5S rRNA of the horsetail Equisetum arvense could be determined: pGUGGUGCGGUCAUACCAGCGCUAAUGCACCGGAUCCCAUCAGAACUCCGCAGUIJA AGCGCGCUUGGGCCAGAACAGUACUGGGAUGGGUGACCUCCCGGGAAGUCCUGGUGCCGCACCCC OH . This sequence exhthits all features expected for higher plant cytoplasmic 5S rRNAs, and can be fitted to the secondary structure model for 5S rRNA proposed by De Wachter et al. (15).

This publication has 0 references indexed in Scilit: