The nucteotide sequence of the cytoplasmtc 5S rRNA from the horsetail,Equisetum arvense
Open Access
- 10 February 1984
- journal article
- research article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 12 (3) , 1577-1580
- https://doi.org/10.1093/nar/12.3.1577
Abstract
Using 3′- and 5′-end labelling sequencing techniques, the following Sesequence for the cytoplasmic 5S rRNA of the horsetail Equisetum arvense could be determined: pGUGGUGCGGUCAUACCAGCGCUAAUGCACCGGAUCCCAUCAGAACUCCGCAGUIJA AGCGCGCUUGGGCCAGAACAGUACUGGGAUGGGUGACCUCCCGGGAAGUCCUGGUGCCGCACCCC OH . This sequence exhthits all features expected for higher plant cytoplasmic 5S rRNAs, and can be fitted to the secondary structure model for 5S rRNA proposed by De Wachter et al. (15).Keywords
This publication has 0 references indexed in Scilit: