The nucleotide sequence of the tRNAMMetet from the archaebacterium Thermoplasma acidophilum
Open Access
- 11 September 1981
- journal article
- research article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 9 (17) , 4387-4390
- https://doi.org/10.1093/nar/9.17.4387
Abstract
Using in vitro labelling techniques, a tRNA MMet from Thermoplasma acidophilum , a member of the Archaebacteriae , has been shown to have the sequence: pGCCGGG Gs 4 UGGCUCANCUGGAGGAGC m 22 GCCGGAC m UCAUt 6 AAUCCGGAGGUCUCGGG ΦΦC m GAUCCCCGAUCCCGGCACCA OH . Despite the small genome size of this nonparasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria. There is no close sequence homology between this tRNA and that of any other methionine tRNA so far sequenced (1Keywords
This publication has 8 references indexed in Scilit:
- Transfer-RNA: The early adaptorThe Science of Nature, 1981
- Compilation of tRNA sequences.1981
- The Phylogeny of ProkaryotesScience, 1980
- An improved direct RNA sequence method; its application to Vida faba 5.8S ribosomal RNANucleic Acids Research, 1980
- [3] Use of in Vitro32P labeling in the sequence analysis of nonradioactive tRNAsPublished by Elsevier ,1979
- A different approach to RNA sequencingNature, 1978
- The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capriNucleic Acids Research, 1978
- Mapping adenines, guanines, and pyrimidines in RNANucleic Acids Research, 1977