Widespread presence in mammals and high binding specificity of a nuclear protein that recognises the single‐stranded telomeric motif (CCCTAA)n

Abstract
We have recently identified a protein in HeLa nuclear extracts which recognises the single‐stranded telomeric sequence (CCCTAA)n in vertebrates [Marsich, E., Piccini, A., Xodo, L. E. & Manzini, G. (1996) Nucleic Acids Res. 24, 4029−4033]. In this paper we provide further experimental evidence, using electrophoretic mobility shift assays, SDS/PAGE after ultraviolet cross‐linking, and gel permeation chromatography techniques, that : (a) this protein displays remarkably stringent requirements for the telomeric motif sequence, as (CCCTAAA)n, (CCCCAA)n and (TCCCAA)n are tightly bound, but (CCTAA)n is not; (b) it requires at least four CCC‐block repeats properly spaced to bind strongly to DNA, e.g. the polypurine stretch of the murine Ki‐ras promoter d(CTCCCTCCCTCCCTCCTTCCCTCCCTCCC), the CarG‐motif‐containing sequence d(CCATTTCCTAATTAGGTAAAAG), and d(C)22 are not recognised by this protein; (c) it is present in nuclear extracts from several vertebrate sources including human, rat, pig, hamster and chicken; (d) its molecular mass is about 40 kDa, as determined by SDS/PAGE and non‐denaturing gel permeation chromatography, suggesting that this protein is monomeric under native conditions.