Study of Mitochondrial DNA Deletion in Alcoholics

Publisher Website
Google Scholar
Abstract
Background: Recently, it has been reported that single or multiple mitochondrial DNA (Mt‐DNA) deletions have been observed frequently in liver tissue and white blood cells (WBC) obtained from patients with alcoholic liver disease (ALD). In this study, we investigated the deletion of the Mt‐DNA encoding adenosine triphosphatase (ATPase) region in WBC to clarify whether Mt‐DNA heteroplasmy caused by alcohol drinking is reversible. Methods: Blood samples were obtained from 4 healthy volunteers, 56 patients with ALD, and 106 nonalcoholic healthy controls. The Mt‐DNA encoded ATPase region was amplified by polymerase chain reaction (PCR) by using two primers: forward primer, 5‘‐AACCAACACCTCTTTACAGTGA; and reverse primer; 5‘‐TTGGTGGGTCATTATGTGTTGT. Results: Heteroplasmy was observed in one volunteer on day 3 and in the remaining persons on day 4 after the start of alcohol consumption. Heteroplasmy was observed for another 6 days after alcohol consumption stopped, but on the 7th day it had disappeared in all volunteers. In WBC Mt‐DNA obtained from ALD patients within 3 days of abstinence, heteroplasmy was observed in 38 of the 56 patients (67.9%), whereas heteroplasmy was not detected in any healthy subjects. In 10 of the 18 ALD patients (56%) who had heteroplasmy within 3 days of abstinence, heteroplasmy disappeared after 4 weeks of abstinence. Conclusion: An acquired mutation of Mt‐DNA, at least in the encoding ATPase region, may result from alcohol drinking and may be reversed by stopping drinking.
Funding Information
  • Grant for Project Research from Kanazawa Medical University