Unusual structural features of the 5S ribosomal RNA fromStreptococcus cremoris
Open Access
- 11 November 1983
- journal article
- research article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 11 (21) , 7569-7557
- https://doi.org/10.1093/nar/11.21.7569
Abstract
The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5′ GGAGAUACACCUGUUCCCAUGAACACAGAAGUUAAGUCCAUCUACGGCGGAAGUACUUGGGGGUUGCCCCCUGGGAGAUAUGCGAGUGGCCAAGU OH 3′.Comparison of the S. cremoris 5S RNA sequence to an updated prokaryotic generalized 5S RNA structural model shows that this 5S RNA contains some unusual structural features. These features result largely from uncommon base substitutions in helices I, II and IV. Some of these unusual structural features are shared by several of the known 5S RNA sequences from mycoplasmas. However, the characteristic bloc of deletions found in helix V of these mycoplasma 5S RNAs is not present in the 5S RNA of S. cremoris.Keywords
This publication has 29 references indexed in Scilit:
- Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.Proceedings of the National Academy of Sciences, 1979
- [44] Protein-RNA interactions in the bacterial ribosomePublished by Elsevier ,1979
- A different approach to RNA sequencingNature, 1978
- Origins of Prokaryotes, Eukaryotes, Mitochondria, and ChloroplastsScience, 1978
- Studies on the Sequence of the 3′‐Terminal Region of Turnip‐Yellow‐Mosaic‐Virus RNAEuropean Journal of Biochemistry, 1977
- Mapping adenines, guanines, and pyrimidines in RNANucleic Acids Research, 1977
- Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotesJournal of Molecular Evolution, 1976
- Structure and function of 5S and 5.8 S RNA.1976
- 5S RNA secondary structureNature, 1975
- Structure and Function of 5S Ribosomal Ribonucleic Acid from Torulopsis utilisII. Partial Digestion with Ribonucleases and Derivation of the Complete SequenceThe Journal of Biochemistry, 1974