Template controlled coupling and recombination of oligonucleotide blocks containing thiophosphoryl groups
- 1 January 1993
- journal article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 21 (6) , 1403-1408
- https://doi.org/10.1093/nar/21.6.1403
Abstract
Oxidation of a pair of 3'- and 5'-thiophosphoryloligonucleotides in the presence of a complementary oligonucleotide template is shown to provide an effective means for selectively linking oligonucleotide blocks. Coupling proceeds rapidly and efficiently under mild conditions in dilute aqueous solutions (microM range for oligomers, 2-15 min at 0-4 degrees C with K3Fe(CN)6 or KI3 as oxidant). This chemistry was demonstrated by polymerization of a thymidylate decamer derivative (sTTTTTTTTTTs) in the presence of poly(dA) and by coupling oligomers possessing terminal thiophosphoryl groups (ACACCCAATTs + sCTGAAAATGG and ACACCCAATs + sCTGAAAATGG) in the presence of a template (CCATTTTCAGAATTGGGTGT). Efficient linking of 5' to 3' phosphoryl groups can be achieved under conditions where virtually no coupling takes place in absence of a template. A novel feature of the chemistry is that catalyzed recombinations of oligomers containing internal -OP(O)(O-)SSP(O)(O-)O- linkages can be directed by hydrogen bonding to a complementary oligonucleotide. Convenient procedures are reported for solid phase synthesis of the requisite oligonucleotide 3'- and 5'-phosphorothioates.Keywords
This publication has 18 references indexed in Scilit:
- Nonenzymatic ligation of double-helical DNA by alternate-strand triple helix formationNucleic Acids Research, 1992
- A new affinity reagent for the site-specific, covalent attachment of DNA to active-site nucleophiles: application to theEcoRI andRsrl restriction and modification enzymesNucleic Acids Research, 1992
- Synthesis and properties of oligonucleotides containing aminodeoxythymidine unitsNucleic Acids Research, 1992
- Disulfide-linked oligonucleotide phosphorothioates: Novel analogues of nucleic acidsJournal of Molecular Evolution, 1991
- Chemical synthesis of oligodeoxynucleotide dumbbellsBiochemistry, 1991
- Cholesteryl-conjugated oligonucleotides: synthesis, properties, and activity as inhibitors of replication of human immunodeficiency virus in cell culture.Proceedings of the National Academy of Sciences, 1989
- Chemical development in the design of oligonucleotide probes for binding to DNA and RNABiochimie, 1988
- Chemical reactions within DNA duplexes Cyanogen bromide as an effective oligodeoxyribonucleotide coupling agentFEBS Letters, 1988
- Template-directed polymerization of oligoadenylates using cyanogen bromideBiochemistry, 1986
- Studies on Some Interactions and Reactions of Oligonucleotides in Aqueous Solution*Biochemistry, 1966