5'-Levulinyl and 2'-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach
- 1 January 1988
- journal article
- research article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 16 (20) , 9443-9456
- https://doi.org/10.1093/nar/16.20.9443
Abstract
The levulinyl group has been employed for protection of the 5''-hydroxyl group in the synthesis of oligoribonucleotides by the phosphoramidite approach, using the acid-labile 2''-tetrahydrofuranyl group. The hydrazine treatment was performed for 10 minutes in order to remove the levulinyl group on controlled pore glass. Four decaribonucleotides (AAAAAAAAAU, GGGGGGGGGU, CCCCCCCCCU and UUUUUUUUUU) and a heneicosamer (GCCUAGCUGAUGAAGGGUGAU) were prepared with an automatic synthesizer in good yields.This publication has 14 references indexed in Scilit:
- Construction of a series of several self‐cleaving RNA duplexes using synthetic 21‐mersFEBS Letters, 1988
- A new solid-phase synthesis of oligoribonudeotides by the pbosphoro-p-anisidate method using tetrahydrofuranyl protection of 2'-hydroxyl groupsNucleic Acids Research, 1987
- Self-cleaving transcripts of satellite DNA from the newtCell, 1987
- Solid phase synthesis of oligoribonucleotides using o-nitrobenzyl protection of 2′-hydroxyl via a phosphite triester approachNucleic Acids Research, 1986
- Solid-phase synthesis of oligoribonucleotides.1985
- Polymer support oligonucleotide synthesis XVIII1.2): use ofβ-cyanoethyi-N,N-dialkylamino-/N-morpholino phosphoramidite of deoxynucleosides for the synthesis of DNA fragments simplifying deprotection and isolation of the final productNucleic Acids Research, 1984
- Solid-phase synthesis of polynucleotides. III. Synthesis of polynucleotides with defined sequences by the block coupling phosphotriester methodNucleic Acids Research, 1980
- Studies on the Sequence of the 3′‐Terminal Region of Turnip‐Yellow‐Mosaic‐Virus RNAEuropean Journal of Biochemistry, 1977
- DNA sequence analysis: a general, simple and rapid method for sequencing large oligodeoxyribonucleotide fragments by mappingNucleic Acids Research, 1974
- Optical properties of sixteen dinucleoside phosphatesJournal of Molecular Biology, 1966