The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum
Open Access
- 1 January 1980
- journal article
- research article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 8 (23) , 5535-5539
- https://doi.org/10.1093/nar/8.23.5535
Abstract
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoidum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).Keywords
This publication has 6 references indexed in Scilit:
- Nucleotide sequence of a 5S ribosomal RNA gene in the sea urchin Lytechinus variegatusNucleic Acids Research, 1980
- The nucleotide sequence of 5S ribosomal RNA from Micrococcus IysodeikticusNucleic Acids Research, 1980
- Direct chemical method for sequencing RNA.Proceedings of the National Academy of Sciences, 1979
- Collection of published 5S and 5.8S RNA sequences and their precursorsNucleic Acids Research, 1979
- Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.Proceedings of the National Academy of Sciences, 1979
- Characterization of Ribosomes in the Cellular Slime Mold, Dictyostelium discoideumThe Journal of Biochemistry, 1970