p53 Antisense Oligonucleotide Inhibits Growth of Human Colon Tumor and Normal Cell Lines

Open Access
Publisher Website
Google Scholar
Abstract
We examined the relationship between the expression of mutant p53 proteins and tumor cell growth using a p53 antisense oligonucleotide (5′‐CCCTGCTCCCCCCTGGCTCC‐3′). The oligonucleotide inhibited the growth of three human colon tumor cell lines (DLD‐1, SW620 and WiDr), which produce only mutant p53 proteins with different mutation sites. Treatment of DLD‐1 cells with the p53 antisense oligonucleotide caused a decrease in the level of p53 mutant protein. Synthesis of DNA in DLD‐1 and SW620 cells was inhibited more potently than that of RNA or protein after antisense treatment. Furthermore, these cells were accumulated in the S phase when DNA synthesis was inhibited. Meanwhile, the antisense oligonucleotide also inhibited the growth of three human normal cell lines (WI‐38, TIG‐1 and Intestine 407). While treatment of WI‐38 and TIG‐1 cells with the antisense oligonucleotide inhibited synthesis of DNA more potently than that of RNA or protein, these normal cells were accumulated in the G0/G1 phase. These results suggest that p53 proteins, either with or without mutation, play a pivotal role in the growth of tumor and normal cells, but that mutant and wild‐type p53 proteins may function differently in cell growth.