Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides
Open Access
- 1 January 1985
- journal article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 13 (18) , 6447-6465
- https://doi.org/10.1093/nar/13.18.6447
Abstract
Nucleoside 3′-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribo-nucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-pposition. A new o6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatria-contanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.Keywords
This publication has 9 references indexed in Scilit:
- Solid-phase synthesis of the self-complementary hexamer d(c7GpCpc7GpCpc7GpC) via the O-3′-phosphoramidite of 7-deaza-2′-deoxyguanosineNucleic Acids Research, 1985
- Methylation of thymine residues during oligonucleotide synthesisNucleic Acids Research, 1985
- Construction and Evaluation of an Instrument for the Automated Synthesis of OligodeoxyribonucleotidesDNA, 1984
- SYNTHESIS AND USE OF SYNTHETIC OLIGONUCLEOTIDESAnnual Review of Biochemistry, 1984
- A rapid deprotection procedure for phosphotriester DNA synthesisNucleic Acids Research, 1984
- Studies on transfer ribonucleic acids and related compounds. XLV. Block condensation of ribooligonucleotides containing 2' -O-tetrahydrofuranyl-5' -O-dimethoxytritylnucleosidesNucleic Acids Research, 1983
- Automated Synthesis of Gene FragmentsScience, 1981
- Synthesis of oligodeoxyribonucleotides on silica gel supportNucleic Acids Research, 1981
- DNA chain length markers and the influence of base composition on electrophoretic mobility of oligodeoxyribonucleotides in plyacrylamide-gelsNucleic Acids Research, 1979