Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support
- 1 January 1980
- journal article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 8 (22) , 5193-5206
- https://doi.org/10.1093/nar/8.22.5193
Abstract
Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.Keywords
This publication has 10 references indexed in Scilit:
- [57] Sequencing end-labeled DNA with base-specific chemical cleavagesPublished by Elsevier ,2004
- Rapid synthesis of oligodeoxyribonucleotides IV. Improved solid phase synthesis of oligodeoxy-ribonucleotides through phosphotriester intermediatesNucleic Acids Research, 1980
- Synthesis of oligonucleotides on cellulose by a phosphotriester methodNucleic Acids Research, 1980
- Synthesis of the human insulin gene. Part II. Further improvements in the modified phosphotriester method and the synthesis of seventeen deoxyribooligonucleotide fragments constituting human insulin chains B and mini-C DNANucleic Acids Research, 1979
- Rotected deoxyribonucleoside-3′ aryl phosphodiesters as key intermediates in polynucleotide synthesis. Construction of an icosanucleotide analogous to the sequence at the ends of Rous sarcoma virus 35S RNANucleic Acids Research, 1979
- Rapid synthesis of oligodeoxyribonucleotides on a grafted polymer supportNucleic Acids Research, 1979
- Studies on polynucleotides. 146. High-pressure liquid chromatography in polynucleotide synthesisBiochemistry, 1978
- Synthesis and cloning of operator DNA of the lac operon of E. coliCanadian Journal of Biochemistry, 1977
- Rapid synthesis of oligodeoxyribonucleotides II1. Machine-aided solid-phase syntheses of two nonanucleotides and an octanucleotideNucleic Acids Research, 1977
- Polyamide supports for polypeptide synthesisJournal of the American Chemical Society, 1975